mickeydearp1bp7u mickeydearp1bp7u
  • 02-04-2019
  • History
contestada

How many Representatives voted against the resolution? How many Senators voted against it

Respuesta :

lily6735
lily6735 lily6735
  • 02-04-2019
I’m pretty sure 4 and 7
Answer Link

Otras preguntas

This natural landmark was created by the natural forces of erosion. What is its correct name and location?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
There are 23 tables in the library. Each table has 4 chairs. Third grader fill the chairs at 3 tables. Fourth graders fill the chairs at 6 tables. The rest of t
The sum of three numbers is 84 the second number is 2 times the third the first number is 8 more than the third what are the numbers
Susan ........ (Run) to school because she was late.
how would u form a superlative for the adverb widely
Which powerful religious group often tried to close the theaters in Shakespeare's time? A. the Puritans B. the King's Men C. the Pilgrims D. the Jacobites
Two taps A and B fill a swimming pool together in two hours. Alone, it takes tap A three hours less than B to fill the same pool. How many hours does it take ea
Which statement accurately describes the significance of the Magna Carta? A. It gave absolute power to the English king over the church and nobility. B.
Why is California warm and moderately humid but Nevada is hot and dry? A. The two states are at different latitudes. B. As air moves west over California's mo