martha96 martha96

02-10-2019
History

contestada

how long has the islamic religion been around

Respuesta :

jeramiekim jeramiekim

02-10-2019

Answer: 1409 years

Explanation:

2019 ( current year ) - 610 ( when Islam was founded as an Religion )=

1409 years Islam has been around for ( as a religion )

Answer Link

Otras preguntas

Line s has an equation of y=8x+7. Line t is perpendicular to line s and passes through (–8,–2). What is the equation of line t?Write the equation in slope-inter

balance copper (II) sulphate + sodium hydroxide-> copper (II) hydroxide + sodium sulphate

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

Examples of productivity in economics.

pls helpppp Solve for x.

luzon lowland folksongs have a very distinctive Spanish influence.

What is the best way to take a picture of a sun or the moon without making it look blurry or too bright

The following is a sample question for brainliest. Brainliest will be given to the person who can answer the following question with the most details and accura

what do chemical reactions that absorb energy need to occur

(PLEASE HELP WITH THIS DUE SOON WILL GIVE BRAINLIST TO BEST ANSWER) what is the density of an object that has a volume of 8mL and the mass of 22 grams? (show al