Aidenggarcia09 Aidenggarcia09
  • 01-02-2020
  • Mathematics
contestada

The answer was 64cm

Respuesta :

carterale carterale
  • 02-02-2020

Answer:

I'm guessing you want a word problem that answers this?

Step-by-step explanation:

The length of a rectangle is 8 cm more than 3 times its width.

Answer Link

Otras preguntas

How many combinations of 5 students can a teacher choose from 24 students? A. 5,100,480 B. 42,504 C. 7,962,624 D. 120
How well did feudalism establish order in the Middle ages?
The process of chemical cycling is known as a biogeochemical cycle because it A. takes places over a long period of time B. withdraws the
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
HELPPPPP 35% OF GRADEEEEE.... When John bought his new computer, he purchased an online computer help service. The help service has a yearly fee of $25.50 and a
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
The type and age of rocks found in the mountain range are also found on another continent. What might this mean?
Help pl0x, Algebra 1
5. On average, how many years earlier do smokers die than nonsmokers? (Points : 1) 5 to 6 10 to 11 13 to 14 19 to 20
What is the sum of 6/10 plus 7/12