madjghhcset madjghhcset

04-03-2020
Mathematics

contestada

What is the measure of angle X?
Enter your answer in the box

What is the measure of angle X Enter your answer in the box class=

Respuesta :

michelle5821 michelle5821

04-03-2020

So all angles within a triangle should add up to 180, 102+31= 133 then subtract. 180-133=47
X-47

Answer Link

Otras preguntas

If the measures of two opposite angles of a parallelogram are represented by 3x+40 and x+50 what is the measure of each angle of the parallelogram

The root word graph means to _____. speak, write, read

Which are True or False ?

As the mother of a late-maturing boy, betty is concerned because, when compared to early-maturing boys, late maturers are more likely to ________.

Definition: an event that is made up of two or more outcomes is called ____.

Completa la frase con el mandato correcto. (Complete the sentence with the correct command.) Acabo de limpiar la cocina. Elena, __________ a la tienda para comp

Brainliest, what is the total measure of angles 8 and 5 of angle 7 equals 61

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

I WILL MARK BRAINIEST AND GIVE 50 POINTS 4. Analyze what would happen to this ecosystem if one of the primary consumers was removed from the ecosystem? What wou

find the greatest common divisor of 9 and 27