lexivereen11 lexivereen11

03-04-2020
Mathematics

contestada

If the technician charged $327.50, then the technician worked ___
hours.

Respuesta :

haydenfermier haydenfermier

03-04-2020

how much was he paid per hour

Answer Link

jdre4650 jdre4650

26-05-2020

Answer:

4.5

Step-by-step explanation:

your welcome

Answer Link

Otras preguntas

Take notes on the injustice that existed. For example, for the chapter on women's suffrage, what was life like for women in the 1800's and early 1900's?

What is the volume of the cone below? A. 3967 units B. 132 units3 C. 792 units3 D. 264 units3

Select the items below that are kinds of services.

A closed system initially containing 1×10^-3M H2 and 2×10^-3 at 448°C is allowed to reach equilibrium. Analysis of the equilibrium mixture show s that the conce

i'm horrible at probability problems someone help :(

Solve the triangle. A = 48°, a = 32, b = 27 A) Cannot be solved B) B = 38.8°, C = 113.2°, c ≈ 34.4 C) B = 38.8°, C = 93.2°, c ≈ 43 D) B = 38.8°, C = 9

Solve for ddd: d+\left(-5.004\right)=2.826d+(−5.004)=2.826d, plus, left parenthesis, minus, 5, point, 004, right parenthesis, equals, 2, point, 826 d =d=

Factor 10a3b - 5a2b2 - 15ab

how to draw gogeta..........

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template