autumnriley45 autumnriley45

04-04-2020
Mathematics

contestada

Joe is making lemonade by adding 6 5/8 cups of water. It is too strong, so he adds 1 5/8 cups more. How much water does Joe use?

Respuesta :

roxyjbates roxyjbates

04-04-2020

Answer:

8 1/4 or 8 2/8

Step-by-step explanation:

6+1= 7

5/8+5/8= 10/8 or 1 2/8

1 2/8 + 7= 8 2/8

Simplify

8 1/4 cups

Answer Link

Otras preguntas

Joan is 5 years older than ellen, and 3 years ago the sum of their ages was 17 years. in how many years will joan be 21 years old?

the organ procurement and transplant network divides the united states into geographic regions

What are the different ways of interpreting the title of the short story was it a dream

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

PLEASE HELP ASAPPPPPP An advertiser rents a rectangular billboard that is 44 ft wide and 20 ft tall. The rent is $15 per square foot. For a billboard twice as t

(50)points 5 questions

What is the elapsed time

will give thanks and brainliest What is an informed opinion? an opinion that you agree with an opinion that you don’t agree with an opinion that can be argued

Which of the following was a territory the United States took from Spain after the Spanish–American War? A. Puerto Rico B. Hawaii C. Cuba D. A

Fill in each blank with mitosis or meiosis. humans produce gametes by the process of __________________. a zygote becomes a fetus by the process of_____________