DaniElSabiondo DaniElSabiondo

01-09-2020
French

contestada

HELP PLS, AYUDA PLSSSSSSSSSSSSSS
Como se dice quiero ir al baño en frances

Respuesta :

DaniElSabiondo2 DaniElSabiondo2

01-09-2020

Answer:

Si no me equivoco se dice, Je veux aller à la salle de bain

Answer Link

Otras preguntas

1. Let C be between D and E. Use the Segment addition Postulate to solve for v. DC = 2v-15 CE = 3v-8 DE = 27

Last minute help me please and thank you Which word completes the sentence? When the professional soccer player and the team management could not agree to the

Is America living up to its ideals

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

although the university of georgia was chartered in 1787, in what year did the university actually begin holding classes?

contagion movie question answers infection agent? reservoir host? portal of exit? transmission? portal of entry? suspectible host?

Why should flag burning not be protected by the first amendment?

Sasha had 47 CDs until she won c more in a contest. Write an expression that shows how many CDs Sasha has now.

are you racist ..................................................

NEED ASAPIn which of these pairs of numbers is 2 3/5 greater than the first and less than the second?2.1, 2.32.7, 32 1/2,2 3/42, 2 1/4