raintreelily raintreelily

02-12-2020
History

contestada

Belgium, the Netherlands, and Switzerland are the
Benelux countries.
Select one:
True
False

Respuesta :

26sarandolph 26sarandolph

02-12-2020

Answer:

False

Explanation:

Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

crystal lattice definition

In which sentence does the underlined noun clause function as the object of a preposition. Our group sends whoever requests information a newsletter and a link

Improved functional health can be a positive influence on which health risk/

A new predator is introduced into the ecosystem shown in the food web below. This predator feeds on bees and mice. How will this most likely affect the specie

Homosociality reflects children's tendency to prefer social interactions with

Cuanto es (2x+2y=20) (-2x-6y=-52) con método de igualación y método de suma y resta

Select all that apply: according to fisher, the effects of globalization on indigenous peoples include___________.

In "no witchcraft for sale," why are the farquars particularly happy when teddy is born?

You draw two cards from a standard deck of 52 cards, but before you draw the second card, you put the first one back and reshuffle the deck. (a) are the outcome