dillontmcleod
dillontmcleod dillontmcleod
  • 03-02-2021
  • History
contestada

Chiefs or Buccaneers?

Respuesta :

aidanames1583195
aidanames1583195 aidanames1583195
  • 03-02-2021

Answer: bucaneers

Explanation:

Answer Link
Аноним Аноним
  • 03-02-2021

Answer:

Chiefaneers

Explanation:

Answer Link

Otras preguntas

Which of the following is a monomial A. 12c B. C^2 -16 C. c^2+c+6 D. C^3 +4c^2 -12c + 7
What can be inferred about the Cyclops in this excerpt from Homer’s Odyssey? The land of Cyclops first, a savage kind, Nor tamed by manners, nor by laws confine
What is the elapsed time
What is the scale factor in the dilation? A) 2/5 B) 1/2 C) 2 D) 2 and 1/2
Carl earned $6.20 per hour and worked 6 1/2 hours per day. What is the best estimate of his earning for a five-day work week?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Everyone in the neighborhood has been complaining about the deteriorating condition of the park, but nobody has cleaned it up. why not
Please explain to me how to solve this
How would investment model researchers like rusbult and martz (1995) explain why battered women often return to their abusive partners?
PLEASE HELP!!!! Only 8 of those will match up