lexijanayy2 lexijanayy2
  • 01-03-2021
  • Mathematics
contestada

pls help with this question

pls help with this question class=

Respuesta :

LaTaysiaBarnes24
LaTaysiaBarnes24 LaTaysiaBarnes24
  • 01-03-2021

Answer:

yes

Step-by-step explanation:

it passes the vertical line test

Answer Link

Otras preguntas

The _______ was Franklin Roosevelt's program designed to fight the Great Depression
If you’re over 21 you could be arrested for a DUI if your PAC is at or over ? Thanks
U.s. president woodrow wilson's fourteen points was a proposal based on what post-war principle?
What are two concepts of government democracy?
Do you think social mobility is an easy thing to achieve in the US? Why or why not?
I=$310 P=$1,000 t=5 years
Four hundred people live on a pacific island and 16 are homozygous recessive for a trait that has only two different types of alleles in the population. how man
7. A company's marginal revenue is $10, its marginal cost is $10, and its price is $10. This company is operating in a/an _______ market structure. A
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
plz help 10 pts A temporary magneta easily loses its magnetism.b has two north poles.c keeps its magnetism for a long time.d cannot be destroyed.