zj4nspqmy6 zj4nspqmy6
  • 04-05-2021
  • Mathematics
contestada

help pls people. I need to do this

help pls people I need to do this class=

Respuesta :

aarton aarton
  • 05-05-2021

Answer:

hope someone helps you

Step-by-step explanation:

cause its not gonna be me

Answer Link

Otras preguntas

Both Ghandhi and king set which type of mood in their introduction
what was a power given by the articles of confederation
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Suppose the heights of 18-year-old men are approximately normally distributed, with mean 67 inches and standard deviation 5 inches. (a) what is the probability
You have four coins 1 ¢ 5 ¢ 10 ¢ 25 ¢ How many different sums of money can you select? Use set notation to list all the options you have. How many options wi
A _____ reaction is one that consists of two or more elementary reactions. a. simple b. complex c. single d. double
What can be inferred about the Cyclops in this excerpt from Homer’s Odyssey? The land of Cyclops first, a savage kind, Nor tamed by manners, nor by laws confine
help me asap !!!!!!!!
If the [h+] of a 0.205m solution of phenol (c6h5oh) at 25ºc is 2.340 10-6, what is the ka for phenol? phenol is monoprotic.
I'm not sure how to do this I was not there that day they taught this and idk what some are and it was yesterday so..